En savoir plus

Notre utilisation de cookies

« Cookies » désigne un ensemble d’informations déposées dans le terminal de l’utilisateur lorsque celui-ci navigue sur un site web. Il s’agit d’un fichier contenant notamment un identifiant sous forme de numéro, le nom du serveur qui l’a déposé et éventuellement une date d’expiration. Grâce aux cookies, des informations sur votre visite, notamment votre langue de prédilection et d'autres paramètres, sont enregistrées sur le site web. Cela peut faciliter votre visite suivante sur ce site et renforcer l'utilité de ce dernier pour vous.

Afin d’améliorer votre expérience, nous utilisons des cookies pour conserver certaines informations de connexion et fournir une navigation sûre, collecter des statistiques en vue d’optimiser les fonctionnalités du site. Afin de voir précisément tous les cookies que nous utilisons, nous vous invitons à télécharger « Ghostery », une extension gratuite pour navigateurs permettant de les détecter et, dans certains cas, de les bloquer.

Ghostery est disponible gratuitement à cette adresse : https://www.ghostery.com/fr/products/

Vous pouvez également consulter le site de la CNIL afin d’apprendre à paramétrer votre navigateur pour contrôler les dépôts de cookies sur votre terminal.

S’agissant des cookies publicitaires déposés par des tiers, vous pouvez également vous connecter au site http://www.youronlinechoices.com/fr/controler-ses-cookies/, proposé par les professionnels de la publicité digitale regroupés au sein de l’association européenne EDAA (European Digital Advertising Alliance). Vous pourrez ainsi refuser ou accepter les cookies utilisés par les adhérents de l'EDAA.

Il est par ailleurs possible de s’opposer à certains cookies tiers directement auprès des éditeurs :

Catégorie de cookie

Moyens de désactivation

Cookies analytiques et de performance

Realytics
Google Analytics
Spoteffects
Optimizely

Cookies de ciblage ou publicitaires

DoubleClick
Mediarithmics

Les différents types de cookies pouvant être utilisés sur nos sites internet sont les suivants :

Cookies obligatoires

Cookies fonctionnels

Cookies sociaux et publicitaires

Ces cookies sont nécessaires au bon fonctionnement du site, ils ne peuvent pas être désactivés. Ils nous sont utiles pour vous fournir une connexion sécuritaire et assurer la disponibilité a minima de notre site internet.

Ces cookies nous permettent d’analyser l’utilisation du site afin de pouvoir en mesurer et en améliorer la performance. Ils nous permettent par exemple de conserver vos informations de connexion et d’afficher de façon plus cohérente les différents modules de notre site.

Ces cookies sont utilisés par des agences de publicité (par exemple Google) et par des réseaux sociaux (par exemple LinkedIn et Facebook) et autorisent notamment le partage des pages sur les réseaux sociaux, la publication de commentaires, la diffusion (sur notre site ou non) de publicités adaptées à vos centres d’intérêt.

Sur nos CMS EZPublish, il s’agit des cookies sessions CAS et PHP et du cookie New Relic pour le monitoring (IP, délais de réponse).

Ces cookies sont supprimés à la fin de la session (déconnexion ou fermeture du navigateur)

Sur nos CMS EZPublish, il s’agit du cookie XiTi pour la mesure d’audience. La société AT Internet est notre sous-traitant et conserve les informations (IP, date et heure de connexion, durée de connexion, pages consultées) 6 mois.

Sur nos CMS EZPublish, il n’y a pas de cookie de ce type.

Pour obtenir plus d’informations concernant les cookies que nous utilisons, vous pouvez vous adresser au Déléguée Informatique et Libertés de l’INRA par email à cil-dpo@inra.fr ou par courrier à :

INRA
24, chemin de Borde Rouge –Auzeville – CS52627
31326 Castanet Tolosan cedex - France

Dernière mise à jour : Mai 2018

Menu Logo INRA Logo ISO Logo RARe Logo Agrocampus Ouest - Institut supérieur des sciences agronomiques, agroalimentaires, horticoles et du paysage  Logo AgroParisTech - Institut des sciences et industries du vivant et de l'environnement Logo Aix Marseille Université Logo Université d'Angers Université de Tours

CIRM Centre International de Ressources Microbiennes

Identification moléculaire

Protocoles utilisés par le CIRM CFBP pour l’identification des souches du CIRM-CFBP au niveau de l’espèce ou du genre.

Le tableau ci-dessous résume les schémas MLSA courts et référence les protocoles utilisés.

Targetted taxa

Targetted gene

Primer name

Expected size

Reference

Bacteria

ADNr 16S

A1
B6

1200 bp

Manceau and Horvais, 1997

Burkholderia

gyrB

gyrBB1
gyrBB2

738 bp

Spilker et al., 2009

recA

recAB1
recAB2

704 bp

Spilker et al., 2009

Clavibacter

recA

GyrB-F
gyrB-R

909 bp

Jacques et al., 2012

gyrB

recA-F
recA-R

724 bp

Jacques et al., 2012

Erwinia

leuS

leuSFerwi
leuSRerwi

558 bp

Bourgault et al, 2015 *

recA

recA2di
recA2re

713 bp

Cesbron and Manceau 2010 *

Pantoea

recA

recA2di
recA2re

713 bp

Cesbron and Manceau 2010 *

leuS

leuS3
leuS4

806 bp

Deletoile et al, 2009

Pseudomonas

gyrB

gyrB+271ps
gyrB-1022ps

726 bp

Hwang et al., 2005

rpoD

rpoD+364s
rpoD-1222ps

875 bp

Hwang et al., 2005

Ralstonia

leuS

leuS27-F
leuS819-R

793 bp

Wicker et al., 2012

mutS

mutS-RsF.1570
mutS-RsR.1926

758 bp

Prior and Fegan, 2005

Rhizobiceae**

recA

F7386
F7387

779 bp

Shams et al., 2013

rpoB

rpoB-456F
rpoB-456R

620 bp

Martens et al., 2008

Xanthomonas

gyrB

X-gyrB1F
X-gyrB1R

904 bp

Fischer-Le Saux et al., 2015

rpoD

emirpo11F
emirpo13R

1313 bp

Fischer-Le Saux et al., 2015

rpoD

rpoDX-SOF4
rpoDX-SOR6

951 bp

Fischer-Le Saux et al., 2015

* Pour les protocoles complets, voir ci-dessous.

** Le protocole développé pour les rhizobiacées a été utilisé pour les souches des genres : Agrobacterium, Allorhizobium, Ensifer, Neorhizobium, Pararhizobium et Rhizobium.

Protocole pour le genre Erwinia :

Gène recA

Primers

Sequence

Expected size

recA2di

ATCTGGAATTCAGCCTG

713 bp

recA2re

TCCATCATGCGCCTGGGTGAAGA

Programme PCR

30X

95°C

95°C

54°C

72°C

72°C

15°C

10'

45''

45''

1'30''

10'

Note : Il est possible d’ajouter du DMSO à 10% dans le mix PCR pour améliorer l’amplication.

Gène leuS

Primers

Sequence

Expected size

leuSFerwi

5' TYTCCATGCTGCCYTAYCCT 3'

558 bp

leuSRerwi

5' TCCAGTTRCGCTGCATGGTT 3'

Programme PCR

30X

95°C

95°C

54°C

72°C

72°C

15°C

10'

45''

45''

1'30''

10'

Note : utiliser du DMSO à 10% dans le mix PCR.

Une partie de ces données est accessibles via l’outil PhyloSearch.
Cet outil permet de comparer une ou plusieurs séquences avec les séquences de la base de données du CIRM-CFBP. Les résultats, qui peuvent guider l’identification, sont donnés sous forme d’arbre phylogénétique.

Références :

 

Bourgault E., Taghouti G., Fischer-Le Saux M. and Portier P. Primers for leuS amplification for Erwinia and related taxa. 2015.

cc

Cesbron S and Manceau C., Primers for recA amplification for Erwinia strains. 2010.

cc

Deletoile, A., et al. (2009). "Phylogeny and identification of Pantoea species and typing of Pantoea agglomerans strains by multilocus gene sequencing." J Clin Microbiol 47(2): 300-310.

Fischer-Le Saux, M., et al. (2015). "Aggressive emerging pathovars of Xanthomonas arboricola represent widespread epidemic clones that are distinct from poorly pathogenic strains, as revealed by multilocus sequence typing." Appl Environ Microbiol. 81(14), 4651–4668.

Hwang, M. S. H., et al. (2005). "Phylogenetic Characterization of Virulence and Resistance Phenotypes of Pseudomonas syringae." Appl Environ Microbiol 71(9): 5182-5191.

Jacques, M.-A., et al. (2012). "Phylogenetic Analysis and Polyphasic Characterization of Clavibacter michiganensis Strains Isolated from Tomato Seeds Reveal that Nonpathogenic Strains Are Distinct from C. michiganensis subsp. michiganensis." Appl Environ Microbiol 78(23): 8388-8402.

Manceau, C. and A. Horvais (1997). "Assessment of genetic diversity among strains of Pseudomonas syringae by PCR-restriction fragment length polymorphism analysis of rRNA operons with special emphasis on P. syringae pv. tomato." Appl Environ Microbiol 63(2): 498-505.

Martens M., Dawyndt P., Coopman R., Gillis M., De Vos P., Willems A. (2008). Advantages of multilocus sequence analysis for taxonomic studies: a case studyusing 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium). IJSEM. 58:  200–214.

Prior P, Fegan M (2005). Recent development in the phylogeny and classification of Ralstonia solanacearum. In: Momol T, Jones JB (eds). Proceedings of the First International Symposium on tomato diseases. ISHS-Acta Horticulturae. pp 127-136.

Shams M., Vial L., Chapulliot D., Nesme X., Lavire C. (2013). Rapid and accurate species and genomic species identification and exhaustive population diversity assessment of Agrobacterium spp. using recA-based PCR. Syst. App. Microb. 36 : 351-358.

Spilker, T., et al. (2009). "Expanded Multilocus Sequence Typing for Burkholderia Species." J Clin Microbiol 47(8): 2607-2610.

Wicker, E., et al. (2012). "Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA." ISME J 6(5): 961-974.