Know more

Our use of cookies

Cookies are a set of data stored on a user’s device when the user browses a web site. The data is in a file containing an ID number, the name of the server which deposited it and, in some cases, an expiry date. We use cookies to record information about your visit, language of preference, and other parameters on the site in order to optimise your next visit and make the site even more useful to you.

To improve your experience, we use cookies to store certain browsing information and provide secure navigation, and to collect statistics with a view to improve the site’s features. For a complete list of the cookies we use, download “Ghostery”, a free plug-in for browsers which can detect, and, in some cases, block cookies.

Ghostery is available here for free: https://www.ghostery.com/fr/products/

You can also visit the CNIL web site for instructions on how to configure your browser to manage cookie storage on your device.

In the case of third-party advertising cookies, you can also visit the following site: http://www.youronlinechoices.com/fr/controler-ses-cookies/, offered by digital advertising professionals within the European Digital Advertising Alliance (EDAA). From the site, you can deny or accept the cookies used by advertising professionals who are members.

It is also possible to block certain third-party cookies directly via publishers:

Cookie type

Means of blocking

Analytical and performance cookies

Realytics
Google Analytics
Spoteffects
Optimizely

Targeted advertising cookies

DoubleClick
Mediarithmics

The following types of cookies may be used on our websites:

Mandatory cookies

Functional cookies

Social media and advertising cookies

These cookies are needed to ensure the proper functioning of the site and cannot be disabled. They help ensure a secure connection and the basic availability of our website.

These cookies allow us to analyse site use in order to measure and optimise performance. They allow us to store your sign-in information and display the different components of our website in a more coherent way.

These cookies are used by advertising agencies such as Google and by social media sites such as LinkedIn and Facebook. Among other things, they allow pages to be shared on social media, the posting of comments, and the publication (on our site or elsewhere) of ads that reflect your centres of interest.

Our EZPublish content management system (CMS) uses CAS and PHP session cookies and the New Relic cookie for monitoring purposes (IP, response times).

These cookies are deleted at the end of the browsing session (when you log off or close your browser window)

Our EZPublish content management system (CMS) uses the XiTi cookie to measure traffic. Our service provider is AT Internet. This company stores data (IPs, date and time of access, length of the visit and pages viewed) for six months.

Our EZPublish content management system (CMS) does not use this type of cookie.

For more information about the cookies we use, contact INRA’s Data Protection Officer by email at cil-dpo@inra.fr or by post at:

INRA
24, chemin de Borde Rouge –Auzeville – CS52627
31326 Castanet Tolosan CEDEX - France

Dernière mise à jour : Mai 2018

Menu Logo INRA Logo ISO 9001:2008 certified Logo RARe Logo Agrocampus Ouest - Institute for life, food and horticultural sciences and landscaping  Logo AgroParisTech - Paris institute of technology for life, food and environmental sciences Logo Aix Marseille University Logo Angers University

Home page

Strains identification

Simplified MLSA schemes used by CIRM-CFBP for strain identification.

Targetted taxa

Targetted gene

Primer name

Expected size

Reference

Bacteria

ADNr 16S

A1
B6

1200 bp

Manceau and Horvais, 1997

Burkholderia

gyrB

gyrBB1
gyrBB2

738 bp

Spilker et al., 2009

recA

recAB1
recAB2

704 bp

Spilker et al., 2009

Clavibacter

recA

GyrB-F
gyrB-R

909 bp

Jacques et al., 2012

gyrB

recA-F
recA-R

724 bp

Jacques et al., 2012

Erwinia

leuS

leuSFerwi
leuSRerwi

558 bp

Bourgault et al, 2015 *

recA

recA2di
recA2re

713 bp

Cesbron and Manceau 2010 *

Pantoea

recA

recA2di
recA2re

713 bp

Cesbron and Manceau 2010 *

leuS

leuS3
leuS4

806 bp

Deletoile et al, 2009

Pseudomonas

gyrB

gyrB+271ps
gyrB-1022ps

726 bp

Hwang et al., 2005

rpoD

rpoD+364s
rpoD-1222ps

875 bp

Hwang et al., 2005

Ralstonia

leuS

leuS27-F
leuS819-R

793 bp

Wicker et al., 2012

mutS

mutS-RsF.1570
mutS-RsR.1926

758 bp

Prior and Fegan, 2005

Rhizobiceae**

recA

F7386
F7387

779 bp

Shams et al., 2013

rpoB

rpoB-456F
rpoB-456R

620 bp

Martens et al., 2008

Xanthomonas

gyrB

X-gyrB1F
X-gyrB1R

904 bp

Fischer-Le Saux et al., 2015

rpoD

emirpo11F
emirpo13R

1313 bp

Fischer-Le Saux et al., 2015

rpoD

rpoDX-SOF4
rpoDX-SOR6

951 bp

Fischer-Le Saux et al., 2015

* For complete protocol, please see below.

** Protocl for rhizobiaceae had been used for Agrobacterium, Allorhizobium, Ensifer, Neorhizobium, Pararhizobium and Rhizobium.

Protocol for Erwinia strains:

recA

Primers

Sequence

Expected size

recA2di

ATCTGGAATTCAGCCTG

713 bp

recA2re

TCCATCATGCGCCTGGGTGAAGA

PCR program

30X

95°C

95°C

54°C

72°C

72°C

15°C

10'

45''

45''

1'30''

10'

Note : DMSO (10%) can be used to enhance PCR reaction.

leuS

Primers

Sequence

Expected size

leuSFerwi

5' TYTCCATGCTGCCYTAYCCT 3'

558 bp

leuSRerwi

5' TCCAGTTRCGCTGCATGGTT 3'

PCR program

30X

95°C

95°C

54°C

72°C

72°C

15°C

10'

45''

45''

1'30''

10'

Note : use DMSO 10% in PCR mix.

Some of the data are available through PhyloSearch.
This web-based tool permit to compare your own sequences with CIRM-CFBP datablase. The results are given as phylogenetic trees.

Références :

 

Bourgault E., Taghouti G., Fischer-Le Saux M. and Portier P. Primers for leuS amplification for Erwinia and related taxa. 2015.

cc

Cesbron S and Manceau C., Primers for recA amplification for Erwinia strains. 2010.

cc

Deletoile, A., et al. (2009). "Phylogeny and identification of Pantoea species and typing of Pantoea agglomerans strains by multilocus gene sequencing." J Clin Microbiol 47(2): 300-310.

Fischer-Le Saux, M., et al. (2015). "Aggressive emerging pathovars of Xanthomonas arboricola represent widespread epidemic clones that are distinct from poorly pathogenic strains, as revealed by multilocus sequence typing." Appl Environ Microbiol. 81(14), 4651–4668.

Hwang, M. S. H., et al. (2005). "Phylogenetic Characterization of Virulence and Resistance Phenotypes of Pseudomonas syringae." Appl Environ Microbiol 71(9): 5182-5191.

Jacques, M.-A., et al. (2012). "Phylogenetic Analysis and Polyphasic Characterization of Clavibacter michiganensis Strains Isolated from Tomato Seeds Reveal that Nonpathogenic Strains Are Distinct from C. michiganensis subsp. michiganensis." Appl Environ Microbiol 78(23): 8388-8402.

Manceau, C. and A. Horvais (1997). "Assessment of genetic diversity among strains of Pseudomonas syringae by PCR-restriction fragment length polymorphism analysis of rRNA operons with special emphasis on P. syringae pv. tomato." Appl Environ Microbiol 63(2): 498-505.

Martens M., Dawyndt P., Coopman R., Gillis M., De Vos P., Willems A. (2008). Advantages of multilocus sequence analysis for taxonomic studies: a case studyusing 10 housekeeping genes in the genus Ensifer (including former Sinorhizobium). IJSEM. 58:  200–214.

Prior P, Fegan M (2005). Recent development in the phylogeny and classification of Ralstonia solanacearum. In: Momol T, Jones JB (eds). Proceedings of the First International Symposium on tomato diseases. ISHS-Acta Horticulturae. pp 127-136.

Shams M., Vial L., Chapulliot D., Nesme X., Lavire C. (2013). Rapid and accurate species and genomic species identification and exhaustive population diversity assessment of Agrobacterium spp. using recA-based PCR. Syst. App. Microb. 36 : 351-358.

Spilker, T., et al. (2009). "Expanded Multilocus Sequence Typing for Burkholderia Species." J Clin Microbiol 47(8): 2607-2610.

Wicker, E., et al. (2012). "Contrasting recombination patterns and demographic histories of the plant pathogen Ralstonia solanacearum inferred from MLSA." ISME J 6(5): 961-974.